Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Fuente: https://expose-news.com/2022/07/04/proof-moderna-created-covid/

Traducción, corrección de la traducción y subrayado del texto relevante: El Blog de Skiper

Ha surgido una evidencia que prueba más allá de toda duda razonable que el gigante farmacéutico Moderna, la compañía que ha ganado miles de millones con la venta de una inyección experimental de Covid-19, en realidad creó el virus Covid-19.

El 23 de febrero, el Daily Mail publicó un artículo que muestra que Moderna ha patentado la secuencia de 19 letras base (nucleótidos) que codifica el sitio Furin Cleavage en Covid-19. 

Por un lector preocupado

Citaron un artículo de científicos en la India, Suiza, Italia y los EE. UU. (cautelosamente titulado: MSH3 Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site) en el que calcularon que las posibilidades de una secuencia de 19 nucleótidos patentada por Moderna que aparecen al azar en Covid-19 en circunstancias en las que no aparece en ningún otro lugar de la naturaleza son 1 entre 3 billones.

Pero fallaron en hacer la deducción obvia de ahí. Si hubieran hecho dicha deducción obvia, ¡me temo que podría haber sido la última deducción científica que publicaron!. Decidieron investigar la secuencia de ARN para el sitio de escisión de Furin en la proteína Spike de Covid-19 para ver si ocurría en algún otro lugar de la naturaleza.

Afortunadamente, el NCBI/NIH ha producido la maravillosa base de datos BLAST que cataloga todas las secuencias de genes en la naturaleza conocidas por el hombre y todas las secuencias de genes sintéticas patentadas conocidas por la oficina de patentes.

Los investigadores eligieron la secuencia Furin Cleavage porque es la única secuencia continua de letras genéticas (secuencia de nucleótidos) en el Covid-19 con más de 3 nucleótidos, que difiere de las letras respectivas en su pariente natural más cercano, el coronavirus de murciélago RaTG13 (todas las demás diferencias son 3 letras o menos de largo). Por lo tanto, fue, con mucho, el mejor candidato para determinar si el covid-19 fue creado por el hombre o no.

El lector podría considerar que es más probable que aparezca un sitio de escisión de Furin en el Sun que en el Daily Mail. Pero esta escisión se refiere a la separación de la espiga del virus en lugar de la separación de la almohada. 

Además, el sitio de escisión de Furin es clave para la patogenicidad de Covid-19. Entonces, si hubiera alguna ganancia de función hecha por el hombre incluida en el virus, aquí es donde uno podría esperar encontrarla.

La secuencia de aminoácidos del sitio de escisión de furina es PRRA (prolina argenina argenina alanina). Cada aminoácido está codificado por un codón, que consta de 3 nucleótidos (letras de secuencia genética). Entonces, todas las diferencias en el código genético entre Covid-19 y RaTG13 tienen como máximo un codón de largo, un aminoácido de largo, aparte de la secuencia de escisión de Furin, que es…

CCT CGG CGG GCA

La secuencia complementaria (la hebra de ADN opuesta de la doble hélice es (GGAGCCGCCCGT) porque C se une con G y A se une con T

El cumplido inverso (lo mismo escrito al revés) es por lo tanto TGCCCGCCGAGG

Los investigadores realizaron una búsqueda de alineación BLAST (Herramienta básica de búsqueda de alineación local) (lo que significa que buscan la secuencia del gen, la secuencia del gen inversa, la secuencia del gen complementaria y la secuencia del gen complementaria inversa) a través de cada secuencia de genes en la naturaleza conocida por el hombre para CTCCTCGGCGGGCACGTAG que es la secuencia de 19 nucleótidos que contiene la Furin Cleavage Sequence, que también aparece en Covid-19, y que se encuentra en realidad en la forma de complemento inverso CTACTGTGCCCGCCGAGGAG patentada por Moderna. Sus resultados de búsqueda se pueden encontrar aquí. 

La Tabla 1 muestra que sí existe en las 5 patentes estadounidenses citadas a continuación…

US9149506B2: Polinucleótidos modificados que codifican septin-4 –https://patents.google.com/patent/US9149506B2/en

Patente 1

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618953P
2013-12-16 Solicitud presentada por Moderna Therapeutics Inc
2014-05-22 Publicación de US20140141067A1
2015-10-06 Publicación de US9149506B2
2015-10-06 Solicitud concedida
2020-01-10 Primer litigio familiar mundial presentado
US9216205B2: Polinucleótidos modificados que codifican granulisina – https:// patents.google.com/patent/US9216205B2/en

Patente 2

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618873P
2013-12-16 Solicitud presentada por Moderna Therapeutics Inc
2014-04-24 Publicación de US20140113960A1
2015-12-22 Publicación de US9216205B2 2015-12-22
Solicitud concedida
proteína ligasa 1 – https://patents.google.com/patent/US9255129B2/en

Patente 3

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618868P
2013-12-16 Solicitud presentada por Moderna Therapeutics Inc
2014-05-22 Publicación de US20140141068A1
2016-02-09 Solicitud concedida
2016-02-09 Publicación de US9255129B2
US9301993B2: polinucleótidos modificados que codifican el factor inductor de apoptosis 1: https://patents.google.com/patent/US9301993B2/en

Patente 4

Inventor: Tirtha Chakraborty, Antonin de Fougerolles
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad para US201261618957P
2013-12- 16 Solicitud presentada por Moderna Therapeutics Inc
2014-04-17 Publicación de US20140107189A1
2016-04-05 Solicitud concedida
2016-04-05 Publicación de US9301993B2
2020-01-10 Primer litigio familiar mundial presentado

US9587003B2: polinucleótidos modificados para la producción de proteínas y péptidos relacionados con la oncología: https://patents.google.com/patent/US9587003B2/en
Patente 5

Inventor: Stephane Bancel, Tirtha Chakraborty, Antonin de Fougerolles, Sayda M. Elbashir, Matthias John, Atanu Roy, Susan Whoriskey, Kristy M. Wood, Paul Hatala, Jason P. Schrum, Kenechi Ejebe, Jeff Lynn Ellsworth, Justin Guild
Asignado actual: ModernaTx Inc 
2012-04-02 Prioridad a US201261618868P
2016-02-04 Solicitud presentada por ModernaTx Inc
2016-06-02 Publicación de US20160152678A1
2017-03-07 Publicación de US9587003B2
2017-03-07 Solicitud concedida

Así que Moderna solicitó por primera vez una patente para la secuencia de 19 nucleótidos en el 2013, el 16 de diciembre. Quizás el 25 de diciembre hubiera sido más apropiado ya que estaba destinado a convertirse en la corona de espinas de Maías27, Marcos15 y Juan19.

La tabla 2: muestra que la secuencia ocurre en Covid-19 desde el nucleótido 23601 hasta el 23619.

La tabla 3: muestra que esta secuencia de genes no existe en la naturaleza (pero 14 partes de nucleótidos sí). 

Decidí comprobar su trabajo. Sí. Los verifiqué de hecho (enviaré una factura a los globalistas). Esto resultó ser un poco un viaje épico. La página de patentes de Google para US9587003B2 no contiene la secuencia del gen. El pdf de la patente no contiene la secuencia del gen y no se puede buscar desde las páginas 101-304. Pero tiene un enlace a una extensa sección de ‘Lista de secuencias’ cuyo enlace no se puede copiar. Así que lo transcribí manualmente con mi mano limpia: http://seqdata.uspto.gov/?pageRequest=docDetail&DocID=US09587003B2

Desde esa página, puede ingresar la ID de secuencia citada en el documento como 11652 y acceder a https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09587003B2&seqID=11652 que tiene lo siguiente en Nucleotides 2751-2733 leyendo al revés…

gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760

CTACGTGCCCGCCGAGGAG patentado por Moderna es el complemento inverso de CTCCTCGGCGGGCACGTAG, la secuencia de 19 nucleótidos que aparece en el ADN de Covid-19 desde el nucleótido 23601-23619 (que, por lo tanto, estaría cubierto por su patente).

Del mismo modo, puede buscar la secuencia en US9149506B2 yendo a https://seqdata.uspto.gov/?pageRequest=viewSequence&DocID=US09149506B2&seqID=11652, con lo cual volverá a encontrar lo mismo

gccctgatca ccatcatggc ccagatcggc agctacgtgc ccgccgagga ggccaccatc 2760

Luego busqué la secuencia del gen de Wuhan Hu1 (alfa) en https://www.ncbi.nlm.nih.gov/nucore/NC_045512 y encontré:

23581 ttatcagact cagactaatt ctcctcggcg ggcacgtagt gtagctagtc aatccatcat de
https://www.ncbi.nlm.nih.gov/nuccore/NC_045512
Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Que tiene la secuencia de 19 nucleótidos CTCCTCGGCGGGCACGTAG de 23601-23619 como se describe en la tabla 3. Luego ejecuté mi propia búsqueda explosiva no alineada de todas las secuencias genéticas patentadas para el complemento inverso directamente (o quizás para un complemento inverso) y obtuve los mismos resultados que los investigadores. Y lo mismo para las otras 3 patentes estadounidenses.

Así que puedo confirmar, y el lector puede confirmar usando los enlaces anteriores, que Moderna solicitó una patente no solo sobre el complemento inverso del sitio de escisión de furina de 12 nucleótidos en Covid-19, sino también sobre la secuencia de 19 nucleótidos que lo contiene como se describe arriba.

Además, no solo solicitaron una patente el 4 de febrero de 2016 con US9587003B2: como se informó en el Daily Mail. De hecho, solicitaron el 16 de diciembre del 2013 cuatro patentes con números: US9149506B2, US9216205B2, US9255129B2, US9301993B2

Así que Moderna había desarrollado la secuencia del gen de 19 nucleótidos que contiene el sitio de escisión de Furin que le da al Covid19 su infectividad para los humanos mediante una investigación patentada de ganancia de función ya en 2013, 6 años antes de que ocurriera el brote de Wuhan. No tres años como se informó en el Daily Mail y luego viralmente en otros lugares.

Así que ahora analizamos las posibilidades de que esto ocurra de forma natural. El documento calcula la probabilidad de que esta secuencia particular de 19 nucleótidos ocurra al azar en un virus de 30,000 nucleótidos como:

(30.000-18) x (1/4)19 = 1,09 x 10-7

Lo cual es correcto porque hay entre 30.000 y 18 lugares para comenzar la secuencia dado que necesita otras 18 letras más para completarla. Pero en realidad hay 29.904 nucleótidos en Wuhan HU1 (alfa). Así que un cálculo más preciso sería:

(29,904-18) x (1/4)19 = 1.087 x 10-7

Luego calculan las posibilidades de que la secuencia de 19 nucleótidos aparezca en la biblioteca patentada de 24.712 secuencias con una longitud media de 3300 nucleótidos. Pero ese cálculo es irrelevante porque la secuencia no apareció aleatoriamente en las solicitudes de las cinco Patentes de Moderna. Se sabía que la secuencia codificaba un sitio de escisión de Furin, que se sabe que proporciona una ganancia de función a los coronavirus.

Eso fue puesto allí deliberadamente y patentado debido a su poder infectante en humanos, que veremos, más adelante en el artículo, resulta del codón AGA de Arginina (R) viral normal (usado en el 45% de los codones de Arginina viral) siendo reemplazado por el codón de arginina humana CGG (utilizado en el 0% de los codones de arginina viral) en el sitio de escisión de furina.

Todo lo que estamos tratando de resolver aquí es cuáles son las posibilidades de que una secuencia de 19 nucleótidos patentada por Moderna aparezca en el Covid-19 por causas naturales, las mutaciones naturales del Bat Coronavirus RaTG13 o en algún otro virus.

Los nucleótidos forman codones que son tripletes. Entonces hay 64 tripletes posibles de los 4 nucleótidos de ADN ACGT (4x4x4 = 64). Pero todos los trillizos ocurren. 61 codifican 20 aminoácidos de forma redundante y 3 son codones de terminación que le indican al ribosoma que deje de producir la proteína.

Pero las cosas no son tan simples porque el sitio de escisión de Furin aparece en la proteína de punta donde debe estar y la proteína de punta solo tiene 1273 × 3 = 3819 nucleótidos. Las posibilidades de que la secuencia de escisión de furina de 19 nucleótidos aparezca en la proteína espiga son 

(3,819-18) x (1/4)19 = 1.389 x 10-8

O dicho de otra forma: 1 entre 72 millones. Esas serían las posibilidades de que una variante en particular, digamos la primera variante de Covid-19, tuviera la secuencia de 19 nucleótidos en el lugar correcto (el pico). Y lo hizo. Entonces, ciertamente por el equilibrio de probabilidades, y ciertamente más allá de una duda razonable (1 en 72 millones es una duda irrazonable) se puede decir que Moderna fabricó el Covid-19. 

PRUEBA 100% BIOQUÍMICA DE QUE EL COVID19 FUE HECHO POR EL HOMBRE

El doble codón CGG utilizado en el sitio de escisión de furina específico de Moderna no se encuentra en ningún otro sitio de escisión de furina en ningún otro virus de la naturaleza. Los sitios de escisión de furina ocurren en otros virus, pero NO en otros betacoronavirus como el Covid-19 y NO en absoluto con el doble codón CGG.

La arginina (R), puede ser codificada por cualquiera de los 6 tripletes: AGG, AGA, CGA, CGC, CGG, CGT. En Covid-19, el sitio de furina (PRRA), tiene 12 nucleótidos (3 x 4). En Covid-19, el doblete RR del sitio de furina está codificado por CGG-CGG.  

Dos bioquímicos, el profesor Antonio R. Romeu y el profesor adjunto Enric Ollé, analizaron el doblete RR de una gran muestra de sitios de escisión de furina de varios tipos de virus. Descubrieron que no había dobletes RR codificados por los codones CGG-CGG en ningún virus de la naturaleza. Observaron que el triplete AGA era el codón mayoritario involucrado en estos dobletes RR virales.

En toda recombinación genética (donde una parte de un genoma se fusiona con otro genoma), el código del donante se pasa al receptor. Pero simplemente NO HAY VIRUS CONOCIDO con un sitio de escisión de furina específico de Moderna (que tiene el par de codones CGG-CGG) que exista para donar un sitio de escisión de furina específico de Moderna a Covid19. Entonces, la única forma en que esa secuencia podría ingresar en el Covid-19 es de Moderna. Moderna fue el donante. La naturaleza no lo era. Quod erat demonstrandum (QED). Caso cerrado. 

Pero se pone peor. Los profesores españoles decidieron analizar el uso del codón de arginina en cada proteína en Covid-19. El encontró lo siguiente…
AGG (13%)
AGA (45%)
CGA (5%)
CGC (10%)
CGG (3%)
CGT (24%). 

Entonces, el triplete de codones AGA era el mayoritario y, curiosamente, CGG era el codón minoritario para la arginina en el virus. 

Pero se pone peor aún.

En el caso específico de la proteína S, de las 42 Argininas (R) que posee, 20 están codificadas por AGA, y solo 2 por CGG. Estos dos, por supuesto, son los dos presentes en el sitio de escisión de Furin específico de Moderna.

Entonces, la única arginina en la proteína de pico que está codificada en Moderna está en el sitio de escisión de furina. Las otras 40 instancias no usan CGG en absoluto. Luego continúan comentando que cada especie individual en la naturaleza tiene sus propias preferencias de codones. Obviamente, a los virus presentes en la naturaleza les gusta AGA, y no les gusta CGG en absoluto.

Pero adivinen qué especie usa CGG para la arginina más que los otros 5 codones de la competencia: sí, la especie es el viejo homo sapiens. Nuestras preferencias de codificación para la arginina son:

AGG (20%)
AGA (20%)
CGA (11%)
CGC (19%)
CGG (21%)
CGT (9%).

Entonces, el codón CGG en el sitio de escisión de furina se habrá producido a través de la investigación de ganancia de función quimérica (combinación de animales humanos)

¿PODRÍA ALGUIEN QUE NO SEA MODERNA HABER CREADO EL COVID-19 UTILIZANDO EL SITIO DE ESCISIÓN DE FURINA ESPECÍFICO DE MODERNA?

“Nuevos documentos muestran que solo 18 meses antes de que aparecieran los primeros casos de Covid-19, los investigadores habían presentado planes para liberar nanopartículas que penetran en la piel y aerosoles que contienen “nuevas proteínas de punta quimérica” de coronavirus de murciélago en murciélagos de cueva en Yunnan, China. También planearon crear virus quiméricos, mejorados genéticamente para infectar a los humanos con mayor facilidad, y solicitaron 14 millones de dólares a la Agencia de Proyectos de Investigación Avanzada de Defensa (Darpa) para financiar el trabajo.

Los documentos, confirmados como genuinos por un ex miembro de la administración Trump, muestran que esperaban introducir “sitios de división específicos para humanos” para los coronavirus de murciélago, lo que facilitaría que el virus ingrese a las células humanas. 
Cuando el covid-19 se secuenció genéticamente por primera vez, los científicos estaban desconcertados acerca de cómo el virus había desarrollado una adaptación tan específica para los humanos en el sitio de escisión de la proteína espiga, que es la razón por la que es tan infeccioso”. 
 the Telegraph

Puedo ver a todos los grandes periodistas en el Daily Mail y el Telegraph (sin mencionar a los científicos de todo el mundo) haciendo toda esta investigación sobre el Covid19 y llegando a la inevitable conclusión lógica de que hubo una fuga accidental o deliberada en un laboratorio y luego teniendo que redactar sus conclusiones de tal manera que etiqueten esa fuerte probabilidad solo como una posibilidad débil. 

Pero aquí arriba lo hemos demostrado como un hecho (dado que el codón CGG de la secuencia de escisión de furina específica de Moderna no se encuentra en ningún sitio de escisión de furina en ningún virus natural y, por lo tanto, no puede haber sido el resultado de una recombinación genética natural. Por lo tanto, tiene que ser el resultado de una inserción genética hecha por el hombre. 

En teoría, otra parte involucrada con la NAIAD o los NIH podría haber utilizado el sitio de escisión de furina patentado por Moderna y luego crear el Covid19 ellos mismos. Esto no habría violado ninguna patente de Moderna. El sitio de escisión de Furin en sí mismo no es patentable y se conoce desde al menos el año 2004.

US7223390B2: Inserción de sitios de escisión de furina proteasa en proteínas de membrana y usos de los mismos 
2004-05-07 Solicitud presentada por Research Development Foundation
2004-11-11 Publicación de US20040224391A1
2007-05-29 Solicitud concedida

Aunque Moderna en realidad podría haber patentado la codificación Moderna Specific (CGG para AGA) del sitio de escisión de furina, que no se conoce en la naturaleza incluso hoy, si aceptamos que Covid-19 está hecho por el hombre.

Pero dado que la fuga de laboratorio (deliberada o accidental) proviniese de Wuhan, y dado que los chinos lo encubrieron y dado que Fauci desmintió y fue expuesto por el senador Rand Paul, y dado que los NIH, los encubrimientos del NIAID y los servicios de inteligencia de EE.UU. encubrieron todo el asunto, cuando su  informe de 3 meses sobre el origen de Covid-19 ordenado por el imitador presidencial Biden no arrojó nada, y dadas las relaciones entre el NIAID, el NIH, el WIV, EcoHealth Alliance, la Universidad de Carolina del Norte y Moderna, no puedo ver ninguna habitación. para cualquier otra persona.

Además, toda la camarilla profana de malos actores comenzó a desarrollar Moderna Vaccine antes de que ocurriera la pandemia: https://www.infowars.com/posts/must-watch-nih-claimed-joint-ownership-of-moderna-mrna-vaccine- comenzó-desarrollo-semanas-antes-de-la-pandemia/

Pero las cosas no son tan simples porque la naturaleza ciertamente ha tenido 100.000 años para crear virus humanos y nunca colocó un sitio de escisión de furina específico de Moderna (CGG para AGA) en nada, ni colocó la secuencia de 19 nucleótidos en nada antes.

Sin embargo, dentro de los seis años posteriores en los que Moderna lo patentó, lo encontramos en el Covid-19 y en circunstancias en las que Moderna está trabajando con ese virus. Así que ahí la probabilidad no es de 100.000 a 6 o 16.666 a 1 de que Moderna sea responsable en lugar de la naturaleza. No, la posibilidad es de un 100% porque la naturaleza no lo ha hecho. Nunca lo ha hecho y no hay evidencia de que alguna vez lo hará. Es el hombre el que mezcla codones de arginina humanos y virales, no la naturaleza. 

EL PROFESIONAL LUC MONTAGNIER PASÓ LOS ÚLTIMOS AÑOS DE SU VIDA DEMOSTRANDO QUE EL COVID-19 FUE CREADO POR EL HOMBRE Y QUE CONTENÍA GRAN PARTE DEL CÓDIGO GENÉTICO DEL VIH1.

El profesor Luc Montagnier, antes de morir el 8 de febrero de 2022, hizo un asesinato total del concepto de que el Covid-19 evolucionó naturalmente al demostrar que tenía una equivalencia masiva con el VIH. El siguiente diagrama muestra una región de 275 nucleótidos de Covid-19 que tiene 200 nucleótidos de HIV/SIV (Simian ImmunoVirus) en ella. Y recuerde que hay 61 codones que especifican 20 aminoácidos. Entonces, uno puede decir lo mismo en un promedio de 3 formas diferentes con codones.

Evidencia bioquímica y estadística oficial 100% confirma que Moderna creó el Covid-19

Puede descargar un pdf de su estudio aquí* y los materiales complementarios aquí*. Es muy técnico. Pero ganó el premio Nobel por descubrir el virus del VIH. Entonces, si alguien supiera si el Covid se había potenciado con el VIH, sería él. El señaló que el Covid-19 fue hecho por el hombre al principio de la pandemia y, como resultado, él mismo fue asesinado por la prensa y los verificadores de hechos. Todos los verificadores de hechos que lo atacaron estaban equivocados.

(*: Parece que alguien eliminó deliberadamente los dos pdf adjuntos del artículo original.)

No había ninguna base científica para ninguna de sus verificaciones de hechos. Estos conjuntos no son verificadores de datos en absoluto, por supuesto. Son agencias de desinformación globalistas, hijos de Goebbels, chismosos y negadores de la ciencia. Son tan confiables como una elección estadounidense.

Puedo comprobar un hecho por mí mismo, muchas gracias. No necesito que un estudiante de madraza despierto con lavado de cerebro me diga su opinión sobre un tema que nunca estudió en la universidad.

Dado que hemos demostrado más allá de una duda razonable (más allá de una duda de 1 en 72 millones estáticamente y con un 100% de certeza bioquímicamente del sitio de escisión de furina específico de Moderna) que Moderna hizo el Covid-19 y dado que Moderna y Fauci no han admitido haberlo hecho y, de hecho, han ocultado pruebas en ese sentido, es posible que también estén ocultando algo más.

Porque las dos únicas teorías que quedan ahora son la teoría de la fuga accidental en el laboratorio y la teoría de la fuga deliberada en el laboratorio. Quiero decir que la gran mayoría de las filtraciones políticas no son accidentes. Son estrategias deliberadas para dar ventaja al filtrador o a su pagador. Es bien sabido en la industria de la Tecnología de la Información que los virus aparecen justo cuando se necesitan ventas de antivirus. ¿Por qué las cosas serían diferentes con los virus humanos ahora que también pueden ser creados por el hombre?. Especialmente cuando considera el papel masivo de Bill Gates y su fundación y GAVI y GVAP en el negocio global de vacunación.

La única razón por la que Moderna fabricaría el Covid-19 es para lanzarlo. De lo contrario, todo el ejercicio sería financieramente inútil y comercialmente sin sentido. La razón aducida por Fauci para hacer investigación de ganancia de función es que el hombre necesita estar por delante de la naturaleza o de los malos actores para tener una vacuna a tiempo si una enfermedad muta o es modificada genéticamente por los chinos o los rusos para que sea letal.

Pero para creer eso, uno tiene que creer que Moderna está interesada en salvar la vida de las personas. Lo siento. Todas sus acciones muestran que Moderna está interesada ​​​​en vacunar a las personas sabiendo aún  cuán probable es que eso será lo que les cueste la vida. 

Les interesa la ganancia, la ganancia que proviene de una pandemia. No son salvadores de la humanidad como ellos representan. Son nuestros explotadores y nuestros abusadores.

Produjeron el virus para filtrarlo, para hacerse pasar por nuestros salvadores de su propia fuga. Estas no son las actividades de una figura salvadora. Luc Montagnier estaba tratando de ser nuestro salvador de ellos y fue asesinado (profesionalmente) por sus groupies.

Moderna estaba haciendo una investigación de ganancia de función para liberar el virus y forzar una vacuna para él de una manera que maximizaría sus ganancias. Esa no es una teoría de la conspiración. Es lo que pasó precisamente. El precio de sus acciones subió 20 vecesLo lanzaron para vender sus vacunas y destruir el sistema inmunológico de sus clientes porque nuestro sistema inmunológico reduce sus ganancias. Ese es el negocio de las grandes farmacéuticas. 

La razón por la que el escritor confía tanto en que Moderna o sus agentes crearon y filtraron el Covid-19 y la razón por la que lo llamé así al comienzo de la pandemia para casi tanto ridículo como recibió el profesor Montagnier (Dios lo bendiga) es que el las escrituras dicen en Mateo 27, Marcos 15 y Juan 19 que: 

29 Y ellos (los soldados del gobernador del versículo 27) trenzaron una corona de espinas y la pusieron sobre su cabeza, y una caña en su mano derecha; y se arrodillaron delante de él, y se burlaban de él, diciendo: ¡Salve, rey de los judíos!
30 Y le escupieron, y tomando la caña, le golpearon en la cabeza. (Mateo 27 NVI)

Permítame, pues, suplicar su indulgencia mientras interpreto estas palabras: 

El departamento de defensa de EE.UU. financió el empalme de genes del coronavirus de proteínas Spike (Covid-19) a través de NIH, NIAID y DARPA, que primero infectó a Jesús, a través de su prometido, los Santos del Nuevo Pacto, justo después de que se convirtió en el Rey secular, César para esos santos, los judíos antitípicos, aquellos pactados para ser hijos angelicales de Jacob, los nacidos de nuevo angelicalmente.

Calculamos que la maldición que impidió que Jesús se convirtiera en César para los santos terminó en 2019 Tishri 15 (17/18 de octubre). Glenn Beck hizo un documental que muestra que 10 hospitales en Wuhan tomaron casos con síntomas de Covid19 en octubre de 2019. Sí, amigos. El Covid-19 es una prueba de que Jesús ahora es Rey secular sobre los santos, los judíos antitípicos, los judíos por pacto de salvación angelical, por lo menos.

Pero entonces los soldados le escupieron. Porque así es como se transmite el Covid19, a través de pequeñas gotas de aerosol que se exhalan por la boca. Los soldados le escupieron deliberadamente. ¡No fue una FUGA DE SALIVA!. Golpearon a Jesús en la cabeza porque los santos son la cabeza de la iglesia y contrajeron el Covid19 no por una infección aleatoria, sino por un golpe deliberado con un arma biológica, un ataque armado deliberado. Para obtener más información sobre esto, consulte aquí*.

Entonces, lo que vio el profesor Montagnier con su experiencia en virología, lo vi con mi experiencia teológica. Demostrando que, si bien los verificadores de hechos y la ciencia son mutuamente excluyentes, la ciencia y la teología en realidad están de acuerdo, cuando se entienden correctamente (y esa es una gran advertencia). El Profesor Montagnier nos enseñó que las vacunas causan las variantes. De hecho, la virología básica prohíbe la vacunación masiva durante una pandemia por esa misma razón. El dijo que la curva de muertes sigue la curva de vacunas. Eso sí, paradójicamente, si las vacunas causaron Omicron, ¡entonces nos salvaron de sí mismas!.

HA LLEGADO EL MOMENTO DE HACER QUE LAS PERSONAS Y LAS ORGANIZACIONES RINDAN CUENTAS

Los fabricantes del Covid19, los fabricantes de vacunas genéticas, sus financiadores y sus promotores, que incluyen a casi todos los gobiernos y sectores públicos y servicios de salud del mundo, son por lo tanto culpables de genocidio y crímenes de lesa humanidad. Han llevado la violación genética, la enfermedad y la muerte a la mitad de la población del mundo para enriquecer los bolsillos de las compañías farmacéuticas. Los gobiernos y los sectores públicos de todo el mundo han abandonado la regulación de sus servicios de salud en manos de multimillonarios y corporaciones sin corazón.

En el Reino Unido, todo el impuesto sobre la renta que pagamos va al servicio de salud y todos sus protocolos están determinados por sus reguladores y todos sus reguladores están controlados y financiados por la Big Pharma que busca dañar y luego administrar nuestra salud para su beneficio. Así que cada centavo que gastamos en impuestos sobre la renta nos acerca un paso más a la enfermedad, a la muerte y a la drogodependencia.

Entonces, ¿por qué el profesor Montagnier decidió pasar los últimos años de su vida demostrando que el Covid-19 fue creado por el hombre y que las proteínas de pico y, por lo tanto, las vacunas, eran una amenaza existencial para la especie? ¿Qué le quedaba por probarse a sí mismo o a los demás en el 87-89?. Ciertamente no lo hizo para aumentar su reputación en la profesión.

No, lo que le impulsaba es la misma pasión que lo llevó a descubrir el VIH. Una pasión por SALVAR a la humanidad de los virus y de aquellos que los diseñarían para dañarnos. ¿Y por qué entregó el fantasma en febrero de 2022?. Porque sabía que Omicron tenía las vacunas vencidas. Su trabajo fue hecho por un virólogo más grande incluso que él. Por lo tanto, pudo descansar en paz e ir a ver a algunas personas que entendieron la magnitud de su contribución.

El Covid-19 no se hizo en el 2019. Se hizo a partir del sitio de escisión de furina quimérico específico de Moderna (CGG para AGA) de 19 nucleótidos que no se encuentra en ninguna parte de la naturaleza.
Y cada muerte por el Covid y cada muerte por las vacunas de Covid están aparcadas directamente en la puerta de ModeRNA esperando justicia.

Pero no ejecutaremos esa justicia lo suficientemente rápido. Y por lo tanto, la plaga final sobre la humanidad citada en Apocalipsis 6:8, entregada por el cuarto jinete del apocalipsis, plaga que el mismo Bill Gates ha profetizado, llegará más tarde este año (después de la Guerra y después del Hambre, el segundo y el tercer jinete).